Skip to main content

Table 2 Nucleotide sequence of the primers used in the MSP experiments.

From: The chondroitin/dermatan sulfate synthesizing and modifying enzymes in laryngeal cancer: Expressional and epigenetic studies

Type of primer Nucleotide sequence (5-3)
DSE-UF GTGGAGGTGATGTTGGAGAGAAT
DSE-MF AGGCGACGTCGGAGAGAAC
DSE-UR AAACTACCCACCCAAAACTCCCA
DSE-MR TACCCGCCCGAAACTCCCG
D4ST-UF GGGTGGAGAGTGGTTGGGT
D4ST-MF GTGGAGAGCGGTCGGGC
D4ST-UR AATAACCAACTCCCAAACTACAACA
D4ST-MR CCGACTCCCGAACTACGACG
C4ST-UF TTAGATGGTGGTTGAGTTT
C4ST-MF TTAGACGGCGGTCGAGTTC
C4ST-UR AAAATATAATCACATCCAACTATTAACCA
C4ST-MR ATCGCGTCCAACTATTAACCG
  1. The longer segments of the unmethylated primers are in boldface type and differences between methylated/modified and ummethylated/modified sequence are underlined underlined