Skip to main content

Table 1 Nucleotide sequence of the primers used in RT-PCR experiments

From: The chondroitin/dermatan sulfate synthesizing and modifying enzymes in laryngeal cancer: Expressional and epigenetic studies

Type of primer Nucleotide sequence (5-3)
CHSY1-F AGTGTGTCTGGTCTTATGAGATGCA
CHSY1-R AGCTGTGGAGCCTGTACTGGTAG
CHPF-F GTCAGGACCCGCTACATCAG
CHPF-R CTCTCCGCCGATGAAGTCCT
CHSY3-F CGATGTCTACATCAAAGGTGACAAA
CHSY3-R GCTGGAAGTGGTTGAAAGAAGG
CSGlcAT-F AGAACAACTGCAGGCTCAGATCC
CSGlcAT-R AGAGTGTGGTGTGAAAGGAGCAG
CHST3-F CATATCAAGGGTCTCAGACAAGC
CHST3-R GTACAGGTCGCACAGGAAGAG
C4ST1-F AAGTATGTTGCACCCAGTCATGC
C4ST1-R TTCAAGCGGTTGTTGATTTCTGG
D4ST1-F ACTGGAAGCGGGTGATGAAGG
D4ST1-R AAATCGGACGTGAGGTGGTGC
DSE-F TGGTTGGTGAAAGATGCTCCT
DSE-R GTCCTTTGAAACCCTGGCAG
GAPDH-F TCAAGATCATCAGCAATGCCTCC
GAPDH-R AGTGAGCTTCCCGTTCAGC